View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5570_low_25 (Length: 218)

Name: NF5570_low_25
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5570_low_25
NF5570_low_25
[»] chr1 (2 HSPs)
chr1 (17-100)||(36965496-36965579)
chr1 (168-205)||(36965463-36965500)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 36965579 - 36965496
Alignment:
17 aacaacagatttaatttcaagcattgaaatatttcatgaaataacaaattaatttgtgagggatagtagagtttttctctttgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
36965579 aacaacagatttaatttcaagcattgaaatatttcatgaaataacacattaatttgtgagggatagtagagtttttctctttgt 36965496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 205
Target Start/End: Complemental strand, 36965500 - 36965463
Alignment:
168 tttgttgagagaattaagctttgaccaaggagtattat 205  Q
    ||||||||||||||||||||||||||||| ||| ||||    
36965500 tttgttgagagaattaagctttgaccaagaagtgttat 36965463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University