View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570_low_6 (Length: 382)
Name: NF5570_low_6
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 30652800 - 30652586
Alignment:
| Q |
18 |
tatatatgatatgagtgccaaaaatatctcaacaaaaagagtagatctgtgttgtgagttgtgattaaacaaaaggatatgaaacgtgatggagaaattt |
117 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652800 |
tatatatcatatcagtgc-aaaaatatctcaacaaaaagagtagagctgtgttgtgaggtgtgattaaacaaaaggatatgaaacgtgatggagaaattt |
30652702 |
T |
 |
| Q |
118 |
tagaagtggtgctgggtggaaaacaatcaaagggctcctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652701 |
tagaagtggtgctgggtggaaaacaatcaaagggcttctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaa |
30652602 |
T |
 |
| Q |
218 |
caaatgacaaccacgt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30652601 |
caaatgacaaccacgt |
30652586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 291 - 374
Target Start/End: Complemental strand, 30652524 - 30652441
Alignment:
| Q |
291 |
cctcatcaaagagctaagtacaaacggttacacatttccaaaatccaaatgactacttccttgattttcttctgctttcttctc |
374 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652524 |
cctcatcaaagagctaagcacaaacggttacacatttccaaaatccaaatgactacttccttgattttcttctgctttcttctc |
30652441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University