View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5574_high_8 (Length: 239)
Name: NF5574_high_8
Description: NF5574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5574_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 4960795 - 4960580
Alignment:
| Q |
1 |
aattgaataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgctgtatcacacattttgggagtgtttccaatgtcttggatgctatgcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4960795 |
aattgaataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgttgtatcaca--ttttgggagtgtttccaatgtcttggatgcaatgcat |
4960698 |
T |
 |
| Q |
101 |
tttgtttgcttttcatctttggaacctcactgtgtgttacttataaatttgtgattatctctctaattctctagaaaatgtgtaatggtctgtgctccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4960697 |
tttgtttgcttttcatctttggaacctcactgtgtgttacttataaatttgtgattatctctctaattctctagaaaatgtgtaatggtctctgctccat |
4960598 |
T |
 |
| Q |
201 |
tatttgccacttcgatca |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4960597 |
tatttgccacttcgatca |
4960580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University