View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5575-Insertion-1 (Length: 135)
Name: NF5575-Insertion-1
Description: NF5575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5575-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 28233268 - 28233141
Alignment:
| Q |
8 |
tttagcggtggcggcggcttctcgacagtcacaacaatgttttccggccgtgatggttgacacggacacggcatcgctatgaactttggcacatcatccc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28233268 |
tttagcggtggcggcggcttctcgacagtcacaacaatgttttccggccgtgacggttgacacggacatggcatcgctatgaactttggcacatcatccc |
28233169 |
T |
|
| Q |
108 |
ctggcatcatcactgaaaaactttctcc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28233168 |
ctggcatcatcactgaaaaactttctcc |
28233141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University