View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5575-Insertion-4 (Length: 275)
Name: NF5575-Insertion-4
Description: NF5575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5575-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 27756191 - 27756422
Alignment:
| Q |
8 |
gtcgtttggtggtagatttgatttggagaagatttttgcggcggtggagaagtttaaggcgacgcatttgtatgttgcaccgccggtcatggtggagctg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
27756191 |
gtcgtttggtggtagatttgatttggagaagacttttgcggcggtggagaagtttaaggtgacgcatttgtatgttgctccgccggtgatggtggagctg |
27756290 |
T |
|
| Q |
108 |
atcaagcggcgtgaatttgtgagtggttacgagttgtcgtcgctgaagtatctcgtc---tgtgctgctccattggggaaagatttgatgcaagagtgta |
204 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27756291 |
atcaagcggcgtgaggttgttatcggttacgagttgtcgtcgctgaagtatctcgtcggtggtgctgctccgttggggaaagatttgatgcaagagtgta |
27756390 |
T |
|
| Q |
205 |
ctaagattcttccccatgtccacgtcatccag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27756391 |
ctaagattcttccccatgtccacgtcatccag |
27756422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 27766873 - 27767056
Alignment:
| Q |
18 |
ggtagatttgatttggagaagatttttgcggcggtggagaagtttaaggcgacgcatttgtatgttgcaccgccggtcatggtggagctgatcaagcggc |
117 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| || ||||||||||| |||||| |||||||| |||||||||||| ||||||||| |
|
|
| T |
27766873 |
ggtagatttgatttggagaagactttggcggcggtggagaagtttagggtgacgcatttgtttgttgctccgccggtgatggtggagctggtcaagcggc |
27766972 |
T |
|
| Q |
118 |
gtgaatttgtgagtggttacgagttgtcgtcgctgaagtatctcgtc---tgtgctgctccattggggaaagatttgatgcaag |
198 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||||| | |||| | |||||||||| | ||||||||||||||||||| |
|
|
| T |
27766973 |
gtgaggttgtgagtggttatgatttgtcgtcgctgaagcaactcgccggtggtgctgctcctcttgggaaagatttgatgcaag |
27767056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University