View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5575_low_7 (Length: 341)
Name: NF5575_low_7
Description: NF5575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5575_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 5179394 - 5179303
Alignment:
| Q |
18 |
gaatgaataatcaataccaccaaggtcttggtatctaaattctaaataagttgaactaggattgtcatagaagcttaatttttgagaggaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179394 |
gaatgaataatcaataccaccaaggtcttggtatctaaattctaaataagttgaactaggattgtcatagaagcttaatttttgagaggaat |
5179303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 328
Target Start/End: Complemental strand, 5178955 - 5178912
Alignment:
| Q |
285 |
ataactcacctagatccgctacaagtaaagaacatgaggtgcct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5178955 |
ataactcacctagatccgctacaagtaaagaacatgagatgcct |
5178912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 234
Target Start/End: Complemental strand, 5179209 - 5179174
Alignment:
| Q |
199 |
gaacttattgttataccaaaaaagtaaactagtttc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179209 |
gaacttattgttataccaaaaaagtaaactagtttc |
5179174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 254 - 291
Target Start/End: Complemental strand, 5179176 - 5179139
Alignment:
| Q |
254 |
ttcctaaaattttcataagtcttatgttttaataactc |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5179176 |
ttcctaaaattttcataagttttatgttttaataactc |
5179139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University