View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5575_low_9 (Length: 272)
Name: NF5575_low_9
Description: NF5575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5575_low_9 |
 |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 97 - 251
Target Start/End: Original strand, 33326 - 33481
Alignment:
| Q |
97 |
gctctaaaatcatatatcatgttttggctaaaccaattagaatcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatgt-caaaaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
33326 |
gctctaaaatcatatatcatgttttggctaaaccaattagactcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatatacaaaaa |
33425 |
T |
 |
| Q |
196 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33426 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
33481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 33237 - 33287
Alignment:
| Q |
10 |
atcataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33237 |
atcataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
33287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University