View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576-Insertion-1 (Length: 131)
Name: NF5576-Insertion-1
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576-Insertion-1 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 1730410 - 1730289
Alignment:
| Q |
10 |
agaatgacccaaaacttccttctgactataggtctatttctctcagcattgtggttgtgaaaattgttaccaaaacgatagccaataagattaatactat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1730410 |
agaatgacccaaaacttccttctgactataggtctatttttctcagcattgtggttgtgaaaattgttaccaaaacgatagccaataagattaatactat |
1730311 |
T |
|
| Q |
110 |
tcttccgaattttataagtcta |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1730310 |
tcttccgaattttataagtcta |
1730289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University