View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576-Insertion-11 (Length: 185)
Name: NF5576-Insertion-11
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576-Insertion-11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 8e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 8e-29
Query Start/End: Original strand, 7 - 71
Target Start/End: Original strand, 4609078 - 4609142
Alignment:
| Q |
7 |
acattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609078 |
acattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
4609142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 144 - 185
Target Start/End: Original strand, 4609215 - 4609256
Alignment:
| Q |
144 |
gtaaatgtttgtgatttgataaatttgcattgttttatgatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609215 |
gtaaatgtttgtgatttgataaatttgcattgttttatgatt |
4609256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 36 - 71
Target Start/End: Complemental strand, 43315337 - 43315302
Alignment:
| Q |
36 |
ggctgctgtaaagattcaaactttcttcagaggcta |
71 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43315337 |
ggctgctgtgaagattcaaacttttttcagaggcta |
43315302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University