View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576-Insertion-12 (Length: 145)
Name: NF5576-Insertion-12
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576-Insertion-12 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 1e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 12375438 - 12375570
Alignment:
| Q |
8 |
gcatgtacctttcatttccatagtggagcctcagcctccaccgtaccggagcaccgtgaacatccatctgtattcattgatcatcaccaggccaggtcga |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12375438 |
gcatgtacctttcatttccacagtggagcctcatcctccgtcgtaccggagcatcgtgaacatccatctgtattcattgatcatca-----ccaggtcga |
12375532 |
T |
|
| Q |
108 |
tcaattgccgctagaaggaggggatggttcactgattc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12375533 |
tcaattgccgctagaaggaggggatggttcactgattc |
12375570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 12 - 84
Target Start/End: Original strand, 12402112 - 12402184
Alignment:
| Q |
12 |
gtacctttcatttccatagtggagcctcagcctccaccgtaccggagcaccgtgaacatccatctgtattcat |
84 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| | ||||||||||||||||| ||| ||| ||||| |
|
|
| T |
12402112 |
gtacctatcatttccacggtggagcctcagcctccaccacatcggagcaccgtgaacattcatttgttttcat |
12402184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 106 - 145
Target Start/End: Original strand, 13182584 - 13182623
Alignment:
| Q |
106 |
gatcaattgccgctagaaggaggggatggttcactgattc |
145 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
13182584 |
gatcaattggcgctagaaggaggggatcattcactgattc |
13182623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University