View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576_high_29 (Length: 217)
Name: NF5576_high_29
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576_high_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 47876608 - 47876398
Alignment:
| Q |
1 |
cttaactctagtttgagggaacctagatttgaggtcaatattcttggaaaagtaatgggaattgttgagaattgagataatggtgtagaatatttgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
47876608 |
cttaactctagtttgagggaacctagatttgaggtcaatattcttggaaaagtaatgggaattgttgaga-------taatggtgaagaatatttgttat |
47876516 |
T |
|
| Q |
101 |
ttctctcccttatttcctctacgtaaatatttgttatatctatgtatataactctgaatgagatatatac-tttaatcgagtctatgatgtaattagatt |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| || ||||||| ||||| ||||||||||||||| |
|
|
| T |
47876515 |
ttctctcccttatttcctctacataaatatttgttatttctatgtatataactctgaatgagatatacacttttaatcaagtctctgatgtaattagatt |
47876416 |
T |
|
| Q |
200 |
gatataggacagtttagt |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47876415 |
gatataggacagtttagt |
47876398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University