View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5576_low_16 (Length: 260)

Name: NF5576_low_16
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5576_low_16
NF5576_low_16
[»] chr4 (2 HSPs)
chr4 (103-203)||(37606636-37606737)
chr4 (204-260)||(37606548-37606606)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 103 - 203
Target Start/End: Complemental strand, 37606737 - 37606636
Alignment:
103 aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaattttgtgactaaatttcttgtatt-aaaataggttcggaaacagc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
37606737 aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaagtttgtgactaaatttcttgtattaaaaataggttcggaaacagc 37606638  T
202 ct 203  Q
    ||    
37606637 ct 37606636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 204 - 260
Target Start/End: Complemental strand, 37606606 - 37606548
Alignment:
204 cttttgcttgcatgcacaaagtgaatgtgtgt--cgaatccattaattcctttcttatt 260  Q
    ||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
37606606 cttttgcttgcatgcacaaagtgaatgtgtgtgtcgaatccattaattcctttcttatt 37606548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University