View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576_low_23 (Length: 238)
Name: NF5576_low_23
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 11712217 - 11712420
Alignment:
| Q |
1 |
aatctgttgcttttggatcattcttatgggacgaagaaaactatgttgagtccaagtatccttttcttgctaaatagaagactgtacttgttgannnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712217 |
aatctgttgcttttggatcattcttatgggacgaagaaaactatgttgagtccaagtatccttttcttgctaaatagaagactgtacttgttgatttttt |
11712316 |
T |
 |
| Q |
101 |
nctattcattttagtttgtaaatgtaatgcatggaactttactccaatgaattgattgcaattctaaacaggagttattttacgacatttcagaacttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11712317 |
tctattcattttagtttgtaaatgtaatgcatggaactttactccaatgaattgattgcaattctaaacaggagttattttgcgacatttcagaacttga |
11712416 |
T |
 |
| Q |
201 |
gaaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
11712417 |
gaaa |
11712420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University