View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576_low_27 (Length: 235)
Name: NF5576_low_27
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 19711618 - 19711834
Alignment:
| Q |
15 |
tatttagaaagaatgatgagttatcttaattccatattttaaccaaatcagaaaatgt--ttctatagtctacgcataactctagggtttcaagcactat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19711618 |
tatttagaaagaatgatgagttatcttaattccatattttaaccaaatcagaaaatgtgtttctatagtttacgcataactctagggtttcaagcactat |
19711717 |
T |
 |
| Q |
113 |
ttaatttgaattagcatattatatcacaatgaaattagataacaaagtcaatacaaaagaatcattaactacaccacaagcataatacacagacatgcaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19711718 |
ttaatttgaattagcatattatatcacaatgaaattagataacaaagtcaatagaaaagaatcattaactacaccacaagcataatacacagacatacaa |
19711817 |
T |
 |
| Q |
213 |
ttagaccttcatctcac |
229 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
19711818 |
ttagaccttcatttcac |
19711834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University