View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5576_low_3 (Length: 429)
Name: NF5576_low_3
Description: NF5576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5576_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 20 - 418
Target Start/End: Complemental strand, 47876213 - 47875815
Alignment:
| Q |
20 |
aaggtccatcattcttttttataagaataactgggctcgagaaggagccagtgctatgcgtaattaatccctcgtataacatctcccccaatctgttagc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47876213 |
aaggtccatcattcttttttataagaataactgggctcgagaagggaccagtgctatgcgtaattaatccctcgtataacatctcccccaatctgttagc |
47876114 |
T |
 |
| Q |
120 |
cacttccttttggcggtaagcatggcgatatgaacggtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgctt |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47876113 |
cacttccttttggcggtaagcatagcgatatgaacggtcactttctagttttctcaagttacccccctctccgctcgttgaagaccgcacagtgctgctt |
47876014 |
T |
 |
| Q |
220 |
cnnnnnnnnttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacagctactcctta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47876013 |
gaaaaaaatttacggggcacgacttaactgatcattctgtctctcccacttggaggttgaattatatctttccatcattctgacttacaactactcctta |
47875914 |
T |
 |
| Q |
320 |
cagaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875913 |
cagaagtccttgcaatgcagtaatatgcagtattcatttcaaactgatagtcttctgccccaaatccatgatagtcttctacggccaaaattaagtata |
47875815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University