View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5577-Insertion-4 (Length: 191)
Name: NF5577-Insertion-4
Description: NF5577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5577-Insertion-4 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 191
Target Start/End: Original strand, 2686800 - 2686984
Alignment:
| Q |
7 |
aggaagattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattctatgttaatgctaaatattttgctgattttgttatataggcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686800 |
aggaagattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattctatgttaatgctaaatattttgctgattttgttatataggcta |
2686899 |
T |
|
| Q |
107 |
gtttttcattttaaacaaaaactgaaaatgcagcggcatttttatgaattattgatgtctcaactatgttggcacctaacaaaca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686900 |
gtttttcattttaaacaaaaactgaaaatgcagcggcatttttatgaattattgatgtctcaactatgttggcacctaacaaaca |
2686984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 77
Target Start/End: Original strand, 2693937 - 2694003
Alignment:
| Q |
11 |
agattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattctatgttaatgctaa |
77 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
2693937 |
agattgttgcaacatgttgctgaagatgtgttgaagtgggcaaaggtatcttaaatgttaatgctaa |
2694003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University