View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5577_low_6 (Length: 259)
Name: NF5577_low_6
Description: NF5577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5577_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 38724769 - 38724521
Alignment:
| Q |
1 |
ttctcttaccttctcaaaagccaccttgaatggatcaaaatcatcattcttccacaagcgtgcaaaaggaagtctaagcatcgatcctggagacttagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38724769 |
ttctcttaccttctcaaaagccaccttgaatggatcaaaatcatcattcttccacaagcgtgcaaaaggaagtctaagcatcgatcctggagacttagga |
38724670 |
T |
|
| Q |
101 |
gacgtcgctcttgagctttgagtactatcaccattttgaactagtcttggaggaagtttaagaggcggcatcattggaattacttttccatcacaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38724669 |
gacgtcgctcttgagctttgagtactatcaccattttgaactagtcttggaggaagtttaagaggcggcatcattggaattacttttccatcacaaaaga |
38724570 |
T |
|
| Q |
201 |
gctcatcagcaaatgccatagtaggcaacgaatcctcacaaagcctttg |
249 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38724569 |
gttcatcagcaaatgccatagtaggcaacgaatcctcacaaagcctttg |
38724521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University