View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5578_low_11 (Length: 241)
Name: NF5578_low_11
Description: NF5578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5578_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 41 - 234
Target Start/End: Complemental strand, 37413701 - 37413507
Alignment:
| Q |
41 |
aatcttgttgtactttattgtaactagtttttt-gtctctctcaaaaactccatgtgttattagatgttgttcattatcagtaaactcctccttcagttt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
37413701 |
aatcttgttgtactttattgtaactagtttttttgtctctctcaaaaactccatgtgttattagatgctgttcattatcagtaaactcctccttcagctt |
37413602 |
T |
 |
| Q |
140 |
caactttgtcactctctttcaaagtcaaattgtttccctgtctctccggttctaattataccttcaacattatacaatttcataacttcatctca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37413601 |
caactttgtcactctctttcaaagtcaaattgtttccctgtctctccggttctaattataccttcaacattatacaatttcataacttcttctca |
37413507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University