View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5578_low_9 (Length: 267)

Name: NF5578_low_9
Description: NF5578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5578_low_9
NF5578_low_9
[»] chr8 (1 HSPs)
chr8 (27-150)||(40368868-40368988)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 27 - 150
Target Start/End: Complemental strand, 40368988 - 40368868
Alignment:
27 ttagataactcataacaccaatttgatcataaattaagaggaaaatcatatggtctagttattaaatttcttatctatttaaagttttgaaaaatttaca 126  Q
    |||||||||||||||||||||||||||   |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
40368988 ttagataactcataacaccaatttgat---aaattaagaggaaaatcatatggtctagtttttaaatttcttatctatttaaagttttgaaaaatttaca 40368892  T
127 ataatatttgtaagtttagtggat 150  Q
    ||||||||||||||||||||||||    
40368891 ataatatttgtaagtttagtggat 40368868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University