View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5579-Insertion-1 (Length: 175)
Name: NF5579-Insertion-1
Description: NF5579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5579-Insertion-1 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 6e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 8 - 175
Target Start/End: Original strand, 2686791 - 2686958
Alignment:
| Q |
8 |
tctgtttcaaggaagattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattttatgttaatgctaaatattttgctgattttgtta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2686791 |
tctgtttcaaggaagattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattctatgttaatgctaaatattttgctgattttgtta |
2686890 |
T |
 |
| Q |
108 |
tataggctagtttttcattttaaacaaaaactgaaaatgcagcggcatttttatgaattattgatgtc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686891 |
tataggctagtttttcattttaaacaaaaactgaaaatgcagcggcatttttatgaattattgatgtc |
2686958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 87
Target Start/End: Original strand, 2693928 - 2694003
Alignment:
| Q |
12 |
tttcaaggaagattgttgcaacacgttgctgaggatgtgttgaagtgggcaaaggtgtattttatgttaatgctaa |
87 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
2693928 |
tttcaaggtagattgttgcaacatgttgctgaagatgtgttgaagtgggcaaaggtatcttaaatgttaatgctaa |
2694003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University