View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5580_high_8 (Length: 246)
Name: NF5580_high_8
Description: NF5580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5580_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 92 - 235
Target Start/End: Original strand, 39141720 - 39141867
Alignment:
| Q |
92 |
gcaaatcaatatttatcatggtatggaggtgatttgcaattcaaagtaaatgaacgaaacgcacaggt---at-acttgtagattcacaataagaaagtc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
39141720 |
gcaaatcaatatttatcatggtatggaggtgatttgcaattcaaagtaaatgaacgaaacgcacaggttagatcacttgtagagtcacaataagaaagtc |
39141819 |
T |
 |
| Q |
188 |
aagggatttggaagtatggtgtagatatttaggagtctagtacctttg |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39141820 |
aagggacttggaagtatggtgtagatatttaggagtcaagtacctttg |
39141867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University