View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5580_low_7 (Length: 246)
Name: NF5580_low_7
Description: NF5580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5580_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 39639085 - 39638873
Alignment:
| Q |
18 |
attatggttcgtttcttccattcttgcttgaagcttgcaatgatcaatgttcagatgttcgagaggttccttatctttgttatttaagtgaggtacacaa |
117 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39639085 |
attatggttcatttcttccattattgcttgaagcttgcaatgatcaatgttcagatgttcgagaggttccttatctttgttatttaagtgaggtacacaa |
39638986 |
T |
|
| Q |
118 |
attttctcaaagcgaaaattgaatatcttctcaggcaggtgtttgtgctgagtttggtggatctgttttcaaaccccttgttggaggtcagttactcata |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39638985 |
attttctcaaagcaaaaattgaatatcttctcaggcaggtgtttgtgctgagtttggtggatctgttttcaaaccccttgtcggaggtcagttactcata |
39638886 |
T |
|
| Q |
218 |
ccagtttcatatt |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39638885 |
ccagtttcatatt |
39638873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 93 - 230
Target Start/End: Complemental strand, 33281355 - 33281205
Alignment:
| Q |
93 |
tttgttatttaagtgaggtacacaaattttctcaaagcgaaaattgaatatcttctcaggcag---------------gtgtttgtgctgagtttggtgg |
177 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33281355 |
tttgttatttaa-tgaggtgcacaaattttctcaaagc-aaaattgaatatcttctcaggcagctgtttatggggttggtgtttgtgccgagtttggtgg |
33281258 |
T |
|
| Q |
178 |
atctgttttcaaaccccttgttggaggtcagttactcataccagtttcatatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33281257 |
atctgttttcaaaccccttgttggaggtcagttactcataccagtttcttatt |
33281205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 33281501 - 33281432
Alignment:
| Q |
18 |
attatggttcgtttcttccattcttgcttgaagcttgcaatgatcaatgttcagatgttcgagaggttcc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
33281501 |
attatggttcgtttcttccattcttgcttgaagcttgcaatgatgagtgttcagatgttcgacaggttcc |
33281432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 35663167 - 35663217
Alignment:
| Q |
155 |
ggtgtttgtgctgagtttggtggatctgttttcaaaccccttgttggaggt |
205 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||| || |||||||||||| |
|
|
| T |
35663167 |
ggtgtttgtgctgagtttgggggttctgtgttcaagcctcttgttggaggt |
35663217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University