View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5581-Insertion-8 (Length: 137)

Name: NF5581-Insertion-8
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5581-Insertion-8
NF5581-Insertion-8
[»] chr2 (1 HSPs)
chr2 (8-133)||(16970660-16970779)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 7e-47; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 16970660 - 16970779
Alignment:
8 tgtgacgagtctataaccttaccgttgccaaaaaggcattaaatccaaaatggtcccagcagaagcagaagcagaagggcaagattttctgaatttccca 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||      |||||||||||||||||||||    
16970660 tgtgacgagtctataaccttaccgttgccaaaaaggcattaaatccaaaatggtcctagaagaagcagaagca------caagattttctgaatttccca 16970753  T
108 acttttcacatcaactctcagtaaga 133  Q
    ||||||||||||||||||||||||||    
16970754 acttttcacatcaactctcagtaaga 16970779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University