View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5581_high_15 (Length: 209)
Name: NF5581_high_15
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5581_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 188
Target Start/End: Original strand, 16586448 - 16586478
Alignment:
| Q |
158 |
gacgtggggactataaatcacacctccctat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16586448 |
gacgtggggactataaatcacacctccctat |
16586478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University