View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5581_low_16 (Length: 209)

Name: NF5581_low_16
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5581_low_16
NF5581_low_16
[»] chr2 (1 HSPs)
chr2 (158-188)||(16586448-16586478)


Alignment Details
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 188
Target Start/End: Original strand, 16586448 - 16586478
Alignment:
158 gacgtggggactataaatcacacctccctat 188  Q
    |||||||||||||||||||||||||||||||    
16586448 gacgtggggactataaatcacacctccctat 16586478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University