View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5581_low_3 (Length: 354)
Name: NF5581_low_3
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5581_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 53704608 - 53704281
Alignment:
| Q |
18 |
gttttatgctgtcagcaaaggaggaacaattgctgtgtgcgatgttaatagtcatcgagtttccatttttcagatgacggtgcctgttcaattctccggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704608 |
gttttatgctgtcagcaaaggaggaacaattgctgtgtgcgatgttaatagtcatcgagtttccatttttcagatgacggtgcctgttcaattctccggg |
53704509 |
T |
 |
| Q |
118 |
gatattcactatgtggtgttctctggtgaggatatgttgttggtaaatcggattttggaagaggatttttcggatgaacccaattatgatatgcttgtgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704508 |
gatattcactatgtggtgttctctggtgaggatatgttgttggtaaatcgggttttggaagaggatttttcggatgaacccaattatgatatgcttgtgt |
53704409 |
T |
 |
| Q |
218 |
ataggacggtgggatttacggtttttaagatggattggaatgccatggcatggaatagaattgaagcgttgggtgataaggctttgtttgttggggtgaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704408 |
ataggacggtgggatttacggtttttaagatggattggaatgccatggcatggaatagaattgaagcgttgggtgataaggctttgtttgttggggtgaa |
53704309 |
T |
 |
| Q |
318 |
ttcttcaatgtgtttttctgctggtgat |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53704308 |
ttcttcaatgtgtttttctgctggtgat |
53704281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University