View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5581_low_6 (Length: 335)
Name: NF5581_low_6
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5581_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 54218241 - 54217940
Alignment:
| Q |
18 |
ctggatctttgccatgcatcaaaataggctatgacacaatagttctgaattcatgttccttatgctgcttagatagggcatctcccaccgtattctccaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54218241 |
ctggatctttgccatgcatcaaaataggctacgacacaatagttctgaattcatgttccttatgctgcttagatagagcatctcccaccgtattctccaa |
54218142 |
T |
 |
| Q |
118 |
acccaccttatacactttcttaacaatgcagccacaccactccttgaataacgtctacaccacccaaccccaagagataaggcaacaataactattgacg |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218141 |
atccaccttatacactttcttaacaatgcagccacaccactccttgaataacgtctacaccacccaaccccaagagataaggcaacaataactattgacg |
54218042 |
T |
 |
| Q |
218 |
aaaattacaacccgaatatgtccatcattcacgatcccctaatatgatgaatcaaagtttccttgtcgcatattgatggtgagtgttttaccccacaatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54218041 |
aaaattacaacccgaatatgtccatcattcacgatcccctaatatgatgaatcaaagtttccttgtcgcatattgatggtgagtgttttaccccacaatg |
54217942 |
T |
 |
| Q |
318 |
gt |
319 |
Q |
| |
|
|| |
|
|
| T |
54217941 |
gt |
54217940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University