View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5581_low_8 (Length: 325)
Name: NF5581_low_8
Description: NF5581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5581_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 53704280 - 53703961
Alignment:
| Q |
1 |
tttgtaggatgttgtggagattgtatctatttcacggatgattattcagagggtaatcatgatgatgcttgtgggaaacatgattttggcatctttagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704280 |
tttgtaggatgttgtggagattgtatctatttcacggatgattattcagaggataatcatgatgatgcttgtgggaaacatgattttggcatctttagat |
53704181 |
T |
 |
| Q |
101 |
tatatgatgggatcattgacccgctattgcccagttattctcgaaattcatattctctgttagaatgcccacttccaatttggatttcgccaaatccttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704180 |
tatatgatgggatcattgacccgctattgcccagttattctcgaaattcatattctcggttagaatgcccacttccaatttggatttcgccaaatccttg |
53704081 |
T |
 |
| Q |
201 |
ctaagttgtgtaagttactaagtttagctgcctgtgtttatcagtgtcttatttaggccaatttccaaatgtgctgttcaaaagattgccttattgttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704080 |
ctaagttgtgtaagttactaagtttagctgcctgtgtttatcagtgtcttatttaggccaatttccaaatgtgctgttcaaaagattgccttattgttgt |
53703981 |
T |
 |
| Q |
301 |
atcgtgtatattcatctcac |
320 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
53703980 |
atcgtgtatattcatgtcac |
53703961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University