View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5582_high_11 (Length: 268)
Name: NF5582_high_11
Description: NF5582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5582_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 6 - 163
Target Start/End: Complemental strand, 38591900 - 38591741
Alignment:
| Q |
6 |
aggagcacagaggatttgtatgtggatgaacatgaagggtatgatggagggttgcttaattcgtttgttgggggtacccctacaaaacgtggtgcagggt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38591900 |
aggagtacagaggatttgtatgtggatgaacatgaagggtatgatggagggttgcttaattcgtttgttgggggtacccctacaaaacgtggtgcagggt |
38591801 |
T |
 |
| Q |
106 |
ataccttaatataggttctttattttctcttca--ttgtgtcccattaggttccgtacaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
38591800 |
ataccttaatataggttctttattttctcttcattttgtgtcccattaggttacgtacaa |
38591741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 172 - 252
Target Start/End: Complemental strand, 38591694 - 38591614
Alignment:
| Q |
172 |
attgaattgtttttgtattcttaactctcaataggactggtttttaaattacattgattgatagagtggggttcggttttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38591694 |
attgaattgtttttgtattcttaactctcaataggactggtttttaaattacattgattgatagagtggggttcggttttg |
38591614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University