View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5582_high_12 (Length: 268)
Name: NF5582_high_12
Description: NF5582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5582_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 56342943 - 56343108
Alignment:
| Q |
1 |
gaagacaacaaccactcttcctcttcccttcttgctagtttagaagacagtttgagtgatgcaaacaacgctgatggtttc---ttcgattcaaagagtg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
56342943 |
gaagacaacaaccactcttcctcttcccttcttgcaagtttagaagacagtttgagtgatgcaaacaacgctgatgatgctggtttcgattcaaagagtg |
56343042 |
T |
 |
| Q |
98 |
atgttgggacccgctcctcctttttcagatattcaaatccaagaacaacaatccctccccctcttc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56343043 |
atgttgggacccgctcctcctttttcagaaattcaaatccaagaacaacaatccctccccctcttc |
56343108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 235 - 268
Target Start/End: Original strand, 56343180 - 56343213
Alignment:
| Q |
235 |
gatgactctggagatgattattctaactccattt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
56343180 |
gatgactctggagatgattattctaactccattt |
56343213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University