View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5582_high_17 (Length: 237)
Name: NF5582_high_17
Description: NF5582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5582_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 34070599 - 34070400
Alignment:
| Q |
1 |
acatacatgtgttttttgggagaagatgatcnnnnnnntagagcatgcatatgannnnnnnngggagacaatgattttcttttagattaatgaatattgg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34070599 |
acatacatgttttttttgggagaagatgatcaaaaaaatagagcatgcatatgattttttttgggagacaatgattttcttttagattaatgaatattgg |
34070500 |
T |
 |
| Q |
101 |
ttggaacttggaatctaagtgcaaagaaggataccttgtgggtgcaggtgttgtgaaccaagtgtaatatcccattcgtatagattatagatgagattcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34070499 |
ttggaacttggaatctaagtgcaaagaaggataccttgtgggtgcaggtgttgtgaa-------------cccattcgtatagattatagatgagattcc |
34070413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University