View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5582_low_19 (Length: 239)
Name: NF5582_low_19
Description: NF5582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5582_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 239
Target Start/End: Original strand, 31548581 - 31548810
Alignment:
| Q |
9 |
acatcatcataacagatataccattttgggctaggtcaattcctcgtccagaactttccattgataatggataactgaatatcttgccttctgtgctacg |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31548581 |
acatcatcacaacagatataccattttgggctaggtcaattcctcgtccagaagtttccattgatgatggataactgaatatcttgccttctgtgctacg |
31548680 |
T |
 |
| Q |
109 |
actttcatccggcaacaaaggcctcacgcgacagaatacacggatgttcccttttaactcctgttaaaactgagattgattaataaggtgtctgannnnn |
208 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31548681 |
attttcatctggcaacaaaggcctcacgcgacagaatacacggatgttcccttttaactcctgttaaaactgagattgattaataaggtgtctga-tatt |
31548779 |
T |
 |
| Q |
209 |
nncttataatcaacaaatcttttggttcaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31548780 |
ttcttataatcaacaaatcttttggttcaat |
31548810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University