View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5583-Insertion-7 (Length: 316)
Name: NF5583-Insertion-7
Description: NF5583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5583-Insertion-7 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 8 - 316
Target Start/End: Original strand, 38813918 - 38814226
Alignment:
| Q |
8 |
ctaacaatcatcgaaccaaagttatcgggcttgatgctgaatggcttctgttacatggcacggagccaggaacagttaccaaatccaaatgtgcaaccct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38813918 |
ctaacaatcatcgaaccaaagttatcgggcttgatgctgaatggcttctgttacatggcacggagccaggaacagttaccaaatccaaatgtgcaacact |
38814017 |
T |
 |
| Q |
108 |
gcagctctgtgatggacactcgtgtcttatcattcacctaaatggtttcaattgctttgagagttgggcatatgattctgtccacaaatcactgcttaat |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814018 |
gcagttctgtgatggacactcgtgtcttatcattcacctaaatggtttcaattgctttgagagttgggcatatgattctgtccacaaatcactgcttaat |
38814117 |
T |
 |
| Q |
208 |
tttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814118 |
tttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttg |
38814217 |
T |
 |
| Q |
308 |
aacttggac |
316 |
Q |
| |
|
||||||||| |
|
|
| T |
38814218 |
aacttggac |
38814226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 196 - 314
Target Start/End: Original strand, 38818506 - 38818624
Alignment:
| Q |
196 |
tcactgcttaattttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgta |
295 |
Q |
| |
|
||||| ||||| ||||||||| | ||||||||||| ||||||||||||||||||||||| ||| |||| |||||||| | | ||||| ||||||||| |
|
|
| T |
38818506 |
tcactacttaactttcttcgtatgccaaatgttacctttgttggagttggaatcaaagacaatgtggccaagttggaaacatactatgggattggatgta |
38818605 |
T |
 |
| Q |
296 |
gaaatgctgttgaacttgg |
314 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
38818606 |
gaaatgctgtggaacttgg |
38818624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 316
Target Start/End: Original strand, 38820731 - 38820852
Alignment:
| Q |
195 |
atcactgcttaattttcttcgtctcccaaatgttacatttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgt |
294 |
Q |
| |
|
|||| ||||||||||||||||||| ||| || ||| |||||||| ||||| ||||| | ||||||||||| | |||||| | ||||| || |||| |
|
|
| T |
38820731 |
atcattgcttaattttcttcgtcttccagattatacctttgttggtgttggtatcaatcataatttggctaaacttgagaaggaatatggggttagatgc |
38820830 |
T |
 |
| Q |
295 |
agaaatgctgttgaacttggac |
316 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
38820831 |
agaaatgctgtggaacttggac |
38820852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University