View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5583_low_4 (Length: 364)
Name: NF5583_low_4
Description: NF5583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5583_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 16 - 317
Target Start/End: Complemental strand, 28114316 - 28114015
Alignment:
| Q |
16 |
cagtattgccacttttgataaactaaatacaacagcaggttcttatgcattgttgggatcgaaggttccacgtgatgcgcacgtggtttcgaagctaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28114316 |
cagtattgccacttttgataaactaaatacaacagcaggttcttatgcattgttgggatcgaaggttccacgtgatgcgcacgtggtttcgaagctaagg |
28114217 |
T |
 |
| Q |
116 |
gatgctggtgctatcattctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28114216 |
gatgctggtgctatcattctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggat |
28114117 |
T |
 |
| Q |
216 |
ttggcttggttagtagtactcatcactatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgagcaatagatggattg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28114116 |
ttggcttggttagtagtactcatcactatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgaggaatagatggattg |
28114017 |
T |
 |
| Q |
316 |
tt |
317 |
Q |
| |
|
|| |
|
|
| T |
28114016 |
tt |
28114015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 16 - 256
Target Start/End: Complemental strand, 28129851 - 28129618
Alignment:
| Q |
16 |
cagtattgccacttttgataaactaaatacaacagcaggttcttatgcattgttgggatcgaaggttccacgtgatgcgcacgtggtttcgaagctaagg |
115 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28129851 |
cagtattgcaacttttgacaaactaaatacaacagcaggttcttatgcattgcttggatcaaaggttccacgtgatgcacacgtggtttcgaagctaagg |
28129752 |
T |
 |
| Q |
116 |
gatgctggtgctatcattctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggat |
215 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||| ||||||| | | |||| | || |||||||| |||||||||||| |
|
|
| T |
28129751 |
gatgctggtgccattattctggggaaaactagtctcccagagtggtatggcgctcgttctaccaccatgc---caaaaacttggtgcgctagaggtggat |
28129655 |
T |
 |
| Q |
216 |
ttggcttggttagtagtactcatcactatcactctctctta |
256 |
Q |
| |
|
||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
28129654 |
ttgcattggt---tagtactcatcact-tcactctctctta |
28129618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University