View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5583_low_5 (Length: 327)
Name: NF5583_low_5
Description: NF5583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5583_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 3 - 124
Target Start/End: Complemental strand, 4015707 - 4015586
Alignment:
| Q |
3 |
cttcgctcttaacaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccctatacatcg |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015707 |
cttcgctcttaaaaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccctatacatcg |
4015608 |
T |
|
| Q |
103 |
tgtattccaaaaccattccttc |
124 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4015607 |
tgtattccaaaaccattccttc |
4015586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 4015520 - 4015434
Alignment:
| Q |
130 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctaaaactgtttatggttttgagtactggctctgtgtttggaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015520 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctgaaactgtttatggttttgagtactggctctgtgtttggaa |
4015434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 252 - 308
Target Start/End: Complemental strand, 4015434 - 4015378
Alignment:
| Q |
252 |
atatttgtgaccccagtagagatttcggctttgcctttggatgtgacaattcaactg |
308 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
4015434 |
atatttgtgaccctagtagagatttcgactttgcctttggatgtgataattcaactg |
4015378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Complemental strand, 4017225 - 4017187
Alignment:
| Q |
270 |
gagatttcggctttgcctttggatgtgacaattcaactg |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4017225 |
gagatttcggctttgcatttggatgtgataattcaactg |
4017187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University