View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5583_low_9 (Length: 268)

Name: NF5583_low_9
Description: NF5583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5583_low_9
NF5583_low_9
[»] chr7 (1 HSPs)
chr7 (1-254)||(6324306-6324557)


Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 6324306 - 6324557
Alignment:
1 agagtatatatgcggaggaaaatgcttgattagttgatgagaaaaatgcttggggtaggaaatgaaaatatgtggctggaaaatacaaatcaaggctgga 100  Q
    ||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324306 agagtatatatgcggaggaaaatactt--ttagttgatgagaaaaatgcttggggtaggaaatgaaaatatgtggctggaaaatacaaatcaaggctgga 6324403  T
101 atccatggctaaacacttcccattttaagtgaagaagaaaatgcgtggaattgggttgaactgggaatacttaattacctgggaattcttaagtttgtga 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324404 atccatggctaaacacttctcattttaagtgaagaagaaaatgcgtggaattgggttgaactgggaatacttaattacctgggaattcttaagtttgtga 6324503  T
201 cgcaagaaatgcgtgacaaaataaagataaaagaaaatgaaaatgtatagtata 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324504 cgcaagaaatgcgtgacaaaataaagataaaagaaaatgaaaatgtatagtata 6324557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University