View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584-Insertion-11 (Length: 191)
Name: NF5584-Insertion-11
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 191
Target Start/End: Complemental strand, 48961371 - 48961186
Alignment:
| Q |
6 |
catataggctcctctgttttcccctgcaattgttatcactctcatgccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961371 |
catataggctcctctgttttcccctgcaattgttatcactctcatgccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttc |
48961272 |
T |
 |
| Q |
106 |
acagtaatgtgttttccatgatgggaagaattgctgtgattttgagtctgcctatggaattcaccattgctgtgattttgattctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961271 |
acagtaatgtgttttccatgatgggaagaattgctgtgattttgagtctgcctatggaattcaccattgctgtgattttgattctc |
48961186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University