View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_high_15 (Length: 378)
Name: NF5584_high_15
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 5 - 361
Target Start/End: Original strand, 40042870 - 40043226
Alignment:
| Q |
5 |
atgaactgaggaagaaggccaagagctttttaccagcttgaactcattggacaaaataaacttatttgcctcagctccatttactatcacagttggtgac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40042870 |
atgaactgaggaagaaggccaagagctttttaccagcttgaactcattggacaaaataaacttatttgcctcagctccatttactatcacagttggtgac |
40042969 |
T |
 |
| Q |
105 |
cctatgatccttgttttgaagatctttccgtgtttcgtgattcgaggatgaacaaaatcttcatacaatttgtttctcctttgagcattgaagaattcca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40042970 |
cctatgatccttgttttgaagatctttccgtgtttcgtgattcgaggatgaacaaaatcttcatacaatttgtttctcctttgagcattgaagaattcca |
40043069 |
T |
 |
| Q |
205 |
tggtctctcctatcaatggaaatcccatttcacctggtggaagctttcttttgtctttgttattttgttgcttgtgcctcaagaaattgaaagagaacag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043070 |
tggtctctcctatcaatggaaatcccatttcacctggtggaagctttcttttgtctttgttattttgttgcttgtgcctcaagaaattgaaagagaacag |
40043169 |
T |
 |
| Q |
305 |
agcaaacaggggtaacaagacacatgaaagaatatagataatatctttagacatttt |
361 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043170 |
agcaaacaggggaaacaaaacacatgaaagaatatagataatatctttagacatttt |
40043226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University