View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_high_48 (Length: 223)
Name: NF5584_high_48
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 100 - 209
Target Start/End: Original strand, 9080313 - 9080423
Alignment:
| Q |
100 |
ctcaagcaacattggcacgagacaaccatggataagattgttctcgaacaatggattgtgatgtcaatgaa-ggggattcacagattgcctaggccatgc |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||| ||||||| |
|
|
| T |
9080313 |
ctcaagcaacattggctcgagacaaccatggataagattgttctcgaacaatggattgtgatgtcaatgaagggggattcacggattccctacgccatgc |
9080412 |
T |
 |
| Q |
199 |
atgcttcttct |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
9080413 |
atgcttcttct |
9080423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 9080195 - 9080278
Alignment:
| Q |
18 |
attgatttgttataaaaacagtctagtggtgtagattaaaggtaggaaacctgagatgtaaattgcttcctttgtctcatttct |
101 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9080195 |
attgatttgttataaaaacggtctaatggtgtagattaaaggtaggaaacctgagatgtaaattgcttcctttgtctcatttct |
9080278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University