View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_low_27 (Length: 266)
Name: NF5584_low_27
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 146
Target Start/End: Complemental strand, 46703639 - 46703505
Alignment:
| Q |
12 |
acagactccacattcatgacaattgagaaagaaagaaaagtaaaattaaccaatatactgatgggaacccaacgaaagaaaacagaatgggagctcactt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46703639 |
acagactccacattcatgacaattgagaaagaaagaaaagtaaaattaaccaatatactgatgggaacccaacgaaagaaaacagaatgggagctcactt |
46703540 |
T |
 |
| Q |
112 |
ggttgtgctaagagattaaaggatttaaggagtaa |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46703539 |
ggttgtgctaagagattaaaggatttaaggagtaa |
46703505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University