View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_low_35 (Length: 251)
Name: NF5584_low_35
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_low_35 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 24 - 251
Target Start/End: Original strand, 15794102 - 15794331
Alignment:
| Q |
24 |
aaatttgtatactactagtaactacat-gatatggtccaatgtagtatcaattttacaaccatagacatctcgagttcggctttgcttaacttgctttgc |
122 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |||||| ||||||||||||||||| |||||||| |||||||||||||||||| || |||||| |
|
|
| T |
15794102 |
aaatttgtatactactagta-ctacatagatatggtcaaatgtaatatcaattttacaaccacagacatcttgagttcggctttgcttaatttactttgc |
15794200 |
T |
 |
| Q |
123 |
tctccttttttgtccatttgtgagag---taaacacaagagaacgattaatgatttagcggatcgcactagtgaatccttatgagacattatttggtaaa |
219 |
Q |
| |
|
|||| |||||| || |||| |||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15794201 |
tctcattttttttc-atttttgagagagataaacacaagagaaagattaatgatttagcggatcacactagtgaatccttatgagacattatttggtaaa |
15794299 |
T |
 |
| Q |
220 |
gaatattatcgacaaaattataataataggac |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
15794300 |
gaatattatcaacaaaattataataataggac |
15794331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University