View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_low_38 (Length: 244)
Name: NF5584_low_38
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 11673015 - 11672809
Alignment:
| Q |
17 |
atgaagaaggtagaggaaaagccagatttgcaacttgcagaaaacacaaaaaggcttagacaagcttgtttcaaggctaattacaagaagagaagactca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11673015 |
atgaagaaggtagaggaaaagccagatttgcaacttgcagaaaacacaaaaaggcttagacaagcttgtttcaaagctaattacaagaagagaagactca |
11672916 |
T |
 |
| Q |
117 |
tggttatgaggttaatggatcagtcttctatcagtgaaagttcaagtgttgatgatgatcacaaaatgggtttttaataataaaaatattatcatcaagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
11672915 |
tggttatgaggttaatggatcagtcttctatcagtgaaagttcaaatgttgatgataatcacaaaatgggttattaataataaaaaaattatcatcaagc |
11672816 |
T |
 |
| Q |
217 |
atgtcca |
223 |
Q |
| |
|
||||||| |
|
|
| T |
11672815 |
atgtcca |
11672809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University