View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_low_51 (Length: 217)
Name: NF5584_low_51
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 172
Target Start/End: Complemental strand, 22380561 - 22380409
Alignment:
| Q |
20 |
gataatacatatataagatgatgtgactaaaccatatattgaatgaaattattccaacataattacatctgcggnnnnnnngtaatataaaatcaagtag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
22380561 |
gataatacatatataagatgatgtgactaaaccatatattgaatgaaattattccaacataattacatctgcggaaaaaaagtaatataaaatcaagtgg |
22380462 |
T |
|
| Q |
120 |
tggtaaatatttttctagatctttaataattgttgaaattagtagaagatagg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22380461 |
tggtaaatatttttctagatctttaataattgttgaaattagtagaagatagg |
22380409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 168
Target Start/End: Complemental strand, 22380403 - 22380344
Alignment:
| Q |
108 |
aaaatcaagtagtggtaaatatttttctagatctttaataattgttgaaattagtagaaga |
168 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
22380403 |
aaaatcaagtagtttcaaatatttttctc-atctttaataattgttgatgttagtagaaga |
22380344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University