View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5584_low_53 (Length: 211)
Name: NF5584_low_53
Description: NF5584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5584_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 1696340 - 1696148
Alignment:
| Q |
1 |
tttaactttttctcataatcgattatcatgcatgcatgcataaagtataattttaactttttctgataatcgattttagaagtctttagttcagttacga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1696340 |
tttaactttttatcataatcgattatcatgcatgcatgcataaagtataattttaactttttctgataatcgattttggaagtttttagttcagttacga |
1696241 |
T |
 |
| Q |
101 |
ttgattttagctttttatgttaatcgattaatcatacatgtttctgattgatttttgtgaaatttgaatgcagggaatgttatctcgtttgga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1696240 |
ttgattttagctttttatgttaatcgattaatcatacatgtttctgattgatttttgtgaaatttgaatgcagggaatgttatctcgtttgga |
1696148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 1685794 - 1685599
Alignment:
| Q |
1 |
tttaactttttctcataatcgattatcatgcatgcatgcataaagtataattttaactttttctgataatcgattttagaagtctttagttcagttacga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1685794 |
tttaactttttatcataatcgattatcatgcatgcatgcataaagtataattttaactttttctgataatcgatttttgaagtttttagttcagttacga |
1685695 |
T |
 |
| Q |
101 |
ttgattttagctttttatgttaatcgattaatcatacatgtttctgattgat--ttttgtgaaa-tttgaatgcagggaatgttatctcgtttgga |
193 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1685694 |
ttgattttagctttttgtgttaatcgattaatcatacatgtttctgattgatttttttctgaaattttgaatgaagggaatgttatctcgtttgga |
1685599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University