View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585-Insertion-1 (Length: 147)
Name: NF5585-Insertion-1
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585-Insertion-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 9 - 145
Target Start/End: Complemental strand, 2612496 - 2612360
Alignment:
| Q |
9 |
agcgcaatctttcttgacaattatctctagctacataatgcaaacttgcaatattccagcatccgttttcgagaagatcgaacatatttgcaggaattct |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2612496 |
agcgcaatcttccttgacaattatctctagctacataatgcaaacttgcaatattccagcatccgttttcgagaagatcgaacatatttgcaggaattct |
2612397 |
T |
|
| Q |
109 |
atttagggttctagtattaatcagagaaaatgtcatc |
145 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
2612396 |
atttagggttctagtactaataagagaaaatgtcatc |
2612360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 38 - 145
Target Start/End: Complemental strand, 2612674 - 2612565
Alignment:
| Q |
38 |
gctacataatgcaaacttgcaatattccagcatccgttttcgagaagatcgaacatatttg--caggaattctatttagggttctagtattaatcagaga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| | || ||||| |||||||| || |||||||||| |
|
|
| T |
2612674 |
gctacataatgcaaacttgcaatattccgacattcgtttgtgagaagatcgaacatatttgaaaaaaaaaattatttggggttctactactaatcagaga |
2612575 |
T |
|
| Q |
136 |
aaatgtcatc |
145 |
Q |
| |
|
|||||||||| |
|
|
| T |
2612574 |
aaatgtcatc |
2612565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 29849285 - 29849233
Alignment:
| Q |
13 |
caatctttcttgacaattatctctagctacataatgcaaacttgcaatattcc |
65 |
Q |
| |
|
||||||| |||||||| |||| | |||||||||||||||||||||| ||||| |
|
|
| T |
29849285 |
caatcttccttgacaaatatccatggctacataatgcaaacttgcaacattcc |
29849233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University