View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585-Insertion-11 (Length: 161)
Name: NF5585-Insertion-11
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585-Insertion-11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 42533662 - 42533815
Alignment:
| Q |
8 |
ccttgggtacgttatcatgggaaattcaaaggtctcaatttgaacttgatttgtcctggaaaagatccttcttctggggttgatagtgttggcaccatat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42533662 |
ccttgggtacgttatcatgggaaattcaaaggtctcaatttgaacttgatttgtcctggaaaagatccttcttctggggttgatagtgttggcaccatat |
42533761 |
T |
|
| Q |
108 |
cttctgctcttgttgcatatgttgctattcaagctttgaaacctgatttgatca |
161 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42533762 |
cttctgctcttgttgcatatgctgctattcaagctttgaaacctgatttgatca |
42533815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 55105453 - 55105606
Alignment:
| Q |
8 |
ccttgggtacgttatcatgggaaattcaaaggtctcaatttgaacttgatttgtcctggaaaagatccttcttctggggttgatagtgttggcaccatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55105453 |
ccttgggtacgttatcatgggaaattcaaaggtctcaatttgaacttgatttggcctggtaaagatccttcttctggggttgatagtgttggcaccatat |
55105552 |
T |
|
| Q |
108 |
cttctgctcttgttgcatatgttgctattcaagctttgaaacctgatttgatca |
161 |
Q |
| |
|
| |||||||||||| |||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
55105553 |
cctctgctcttgttacatatgctgctattcaatctttcaaacctgatttgatca |
55105606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University