View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_high_17 (Length: 365)
Name: NF5585_high_17
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 29 - 238
Target Start/End: Original strand, 33262111 - 33262319
Alignment:
| Q |
29 |
tatactaattcttttttaaggnnnnnnntactattatattcctacatataatgaagtaatannnnnnncctataaaaaatatctctagtatgcaaaactt |
128 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33262111 |
tatactaattcttttttaaggaaaaaaatactattatattcctacatataatgaagtaatatttttt-cctataaaaaatatctctagtatgcaaaactt |
33262209 |
T |
 |
| Q |
129 |
gattgttttcctccatacaatattataaataaaaggttaagaaagaatttcaacaaaaacttttgtaagcttgaaatcaaccgcatcttaatttgtttca |
228 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262210 |
gattgttcttctccatacaatattgtaaataaaaggttaagaaagaatttcaacaaaaacttttgtaagcttgaaatcaaccgcatcttaatttgtttca |
33262309 |
T |
 |
| Q |
229 |
taagtgtctg |
238 |
Q |
| |
|
|||||||||| |
|
|
| T |
33262310 |
taagtgtctg |
33262319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University