View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_high_25 (Length: 260)
Name: NF5585_high_25
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 89 - 244
Target Start/End: Complemental strand, 56342827 - 56342672
Alignment:
| Q |
89 |
gaggaagtaggaagtgaattgggatttctgaatgggttggcagtagatctggaggttgatttccatgaagaagttgttcctggatccctcaatacacgag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
56342827 |
gaggaagtaggaagtgaattgggatttctgaatgggttggcagtagatctggaggttgatttccaggaagaagttgttcctggatccctcaacacacgag |
56342728 |
T |
|
| Q |
189 |
cagcctttcgaatttgagtcagttccttcttcaagtgaagcctgcttggatcattc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56342727 |
cagcctttcgaatttgagtcagttccttcttcaagtgaagcctgcttggatcattc |
56342672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University