View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_high_27 (Length: 251)
Name: NF5585_high_27
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 26011362 - 26011600
Alignment:
| Q |
1 |
cttatagaggtgtgctaacatctccagagttatgaaatcagccatttgttatctttcttttctttccttagtttt-ttatcatttggtttagcttagaat |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26011362 |
cttatagaggtgtgctaacatctctagagttatgaaatcagccatttgttatctttcttttctttccttagtttttttatcatttggtttagcttagaat |
26011461 |
T |
|
| Q |
100 |
ttgttactatctgaacaagaatccatcacacaccttttaaaattattgggactatcgtttcatcattagcacactttcaagtgcaactctataaaaatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26011462 |
ttgttactatctgaacaagaatccatcacacaccttttaaaattattgggactatcgtttcatcattagcacactttcaagtgcaactctataaaaatct |
26011561 |
T |
|
| Q |
200 |
atcttccgaatgctatttccttttgcattttcttcctct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26011562 |
atcttccgaatgctatttccttttgcattttcttcctct |
26011600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University