View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5585_high_33 (Length: 235)

Name: NF5585_high_33
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5585_high_33
NF5585_high_33
[»] chr8 (2 HSPs)
chr8 (1-72)||(31856562-31856633)
chr8 (139-224)||(31856708-31856793)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 31856562 - 31856633
Alignment:
1 cagatgtaaattctcaactatatagtaaaattttagaggaaatggatagtgtagtgtcccaatccaaagaag 72  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31856562 cagatgtaaattctcaactatatagtaaaattttagaggaaatggatagtgtagtgtcccaatccaaagaag 31856633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 139 - 224
Target Start/End: Original strand, 31856708 - 31856793
Alignment:
139 gtactagcaagtgggggcaaagtggtcccggcccatttaatccactgttttagacagattggttgaagttttgtgtacacctctct 224  Q
    |||||||||||||||||||||| ||||||| || |||||||||||||||||||||| |||||||||||||||| ||||| ||||||    
31856708 gtactagcaagtgggggcaaagcggtcccgaccgatttaatccactgttttagacaaattggttgaagttttgggtacatctctct 31856793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University