View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_high_33 (Length: 235)
Name: NF5585_high_33
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 31856562 - 31856633
Alignment:
| Q |
1 |
cagatgtaaattctcaactatatagtaaaattttagaggaaatggatagtgtagtgtcccaatccaaagaag |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856562 |
cagatgtaaattctcaactatatagtaaaattttagaggaaatggatagtgtagtgtcccaatccaaagaag |
31856633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 139 - 224
Target Start/End: Original strand, 31856708 - 31856793
Alignment:
| Q |
139 |
gtactagcaagtgggggcaaagtggtcccggcccatttaatccactgttttagacagattggttgaagttttgtgtacacctctct |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || |||||||||||||||||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
31856708 |
gtactagcaagtgggggcaaagcggtcccgaccgatttaatccactgttttagacaaattggttgaagttttgggtacatctctct |
31856793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University